Trademark: 85022778
Word
NABSYS ACTGATCCGATCTTACTGAGATAAACTGAACTG
Status Date
Monday, July 14, 2014
Filing Date
Monday, April 26, 2010
Published for Opposition
Tuesday, April 12, 2011
Abandoned Date
Monday, July 14, 2014
9 Laboratory equipment, namely, bio-analytical devices using electronic detection for nucleic acid analysis and molecular diagnostics
42 Laboratory research in the field of bio-analytics with respect to nucleic acid analysis and molecular diagnostics
Color is not claimed as a feature of the mark.
The mark consists of the wording "NAB" in capital letters and "SYS" in lowercase with the final "S" forming part of a helix with the remaining letters, "CGATTCCGATCTTACTGAGATAAACTGAACTGAAATTCCGATCCGAATCTCAAGATAGATACTA", being a tail therefrom.
NAB SYS ACTGATCCGATCTTACTGAGATAAACTGAACTGAAATTCCGATCCGAATCTCAAGATAGATACTA
Aug 20, 2014
Assignment Of Ownership Not Updated Automatically
Jul 14, 2014
Abandonment Notice Mailed - No Use Statement Filed
Jul 14, 2014
Abandonment - No Use Statement Filed
Oct 19, 2013
Notice Of Approval Of Extension Request Mailed
Oct 17, 2013
Extension 5 Granted
Oct 17, 2013
Extension 5 Filed
Oct 17, 2013
Teas Extension Received
Apr 19, 2013
Notice Of Approval Of Extension Request Mailed
Apr 18, 2013
Extension 4 Granted
Apr 15, 2013
Extension 4 Filed
Apr 15, 2013
Teas Extension Received
Oct 20, 2012
Notice Of Approval Of Extension Request Mailed
Oct 18, 2012
Extension 3 Granted
Oct 18, 2012
Extension 3 Filed
Oct 18, 2012
Teas Extension Received
Jun 5, 2012
Notice Of Approval Of Extension Request Mailed
Jun 4, 2012
Extension 2 Granted
May 10, 2012
Extension 2 Filed
Jun 1, 2012
Case Assigned To Intent To Use Paralegal
May 10, 2012
Teas Extension Received
Oct 21, 2011
Notice Of Approval Of Extension Request Mailed
Oct 19, 2011
Extension 1 Granted
Oct 19, 2011
Extension 1 Filed
Oct 19, 2011
Teas Extension Received
Jun 7, 2011
Noa Mailed - Sou Required From Applicant
Apr 12, 2011
Published For Opposition
Mar 23, 2011
Notice Of Publication
Mar 9, 2011
Law Office Publication Review Completed
Mar 2, 2011
Approved For Pub - Principal Register
Mar 1, 2011
Examiner's Amendment Entered
Mar 1, 2011
Examiners Amendment Mailed
Mar 1, 2011
Examiners Amendment -Written
Dec 7, 2010
Non-Final Action Mailed
Dec 7, 2010
Non-Final Action Written
Dec 3, 2010
Previous Allowance Count Withdrawn
Dec 2, 2010
Approved For Pub - Principal Register
Dec 2, 2010
Examiner's Amendment Entered
Dec 2, 2010
Examiners Amendment Mailed
Dec 2, 2010
Examiners Amendment -Written
Nov 19, 2010
Teas/Email Correspondence Entered
Nov 19, 2010
Correspondence Received In Law Office
Nov 19, 2010
Assigned To Lie
Nov 3, 2010
Teas Response To Office Action Received
Aug 6, 2010
Non-Final Action Mailed
Aug 5, 2010
Non-Final Action Written
Aug 5, 2010
Assigned To Examiner
May 1, 2010
Notice Of Design Search Code And Pseudo Mark Mailed
Apr 30, 2010
New Application Office Supplied Data Entered In Tram
Trademark Alertz updated from USPTO on 2030-01-24